tokens
listlengths 1
168
| tags
listlengths 1
168
|
|---|---|
[
"Serum",
"concentration",
"of",
"FFAs",
"was",
"measured",
"using",
"a",
"HR-NEFA",
"kit",
"(",
"WAKO",
")",
",",
"as",
"described",
"previously",
"."
] |
[
"B-Tissue",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O"
] |
[
"TAGs",
"in",
"serum",
"were",
"determined",
"using",
"the",
"DiaSys",
"Triglycerides",
"FS",
"kit",
"(",
"DiaSys",
"GmbH",
")",
",",
"according",
"to",
"the",
"manufacturer",
"’s",
"instructions",
"."
] |
[
"B-Lipid",
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Lipids",
"from",
"adipose",
"tissue",
"were",
"extracted",
"using",
"a",
"two-step",
"chloroform/",
"methanol",
"procedure",
"."
] |
[
"B-Lipid",
"O",
"B-Tissue",
"I-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Samples",
"were",
"analyzed",
"by",
"direct",
"infusion",
"on",
"a",
"QExactive",
"mass",
"spectrometer",
"(",
"Thermo",
"Scientific",
")",
"equipped",
"with",
"a",
"TriVersa",
"NanoMate",
"ion",
"source",
"(",
"Advion",
"Biosciences",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Further",
"details",
"see",
"section",
"Lipidomic",
"Analysis",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"O"
] |
[
"Lipid",
"extraction",
"and",
"analysis",
"of",
"mouse",
"LV",
"samples",
"(",
"3",
"mg",
"per",
"sample",
")",
"and",
"human",
"plasma",
"(",
"15μl",
"per",
"sample",
")",
"were",
"performed",
"as",
"described",
"previously",
"[",
"58",
",",
"59",
"]",
"at",
"Lipotype",
"GmbH",
":",
"Lipids",
"were",
"extracted",
"using",
"a",
"two-step",
"chloroform/methanol",
"procedure",
"."
] |
[
"B-Lipid",
"O",
"O",
"O",
"O",
"B-Organism",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Samples",
"were",
"spiked",
"with",
"internal",
"lipid",
"standard",
"mixture",
"containing",
":",
"cardiolipin",
"16:1/15:0/15:0/15:0",
"(",
"CL",
")",
",",
"ceramide",
"18:1;2/17:0",
"(",
"Cer",
")",
",",
"diacylglycerol",
"17:0/17:0",
"(",
"DAG",
")",
",",
"hexosylceramide",
"18:1;2/12:0",
"(",
"HexCer",
")",
",",
"lyso-phosphatidate",
"17:0",
"(",
"LPA",
")",
",",
"lyso-phosphatidylcholine",
"12:0",
"(",
"LPC",
")",
",",
"lyso-phosphatidylethanolamine",
"17:1",
"(",
"LPE",
")",
",",
"lyso-phosphatidylglycerol",
"17:1",
"(",
"LPG",
")",
",",
"lyso-phosphatidylinositol",
"17:1",
"(",
"LPI",
")",
",",
"lyso-phosphatidylserine",
"17:1",
"(",
"LPS",
")",
",",
"phosphatidate",
"17:0/17:0",
"(",
"PA",
")",
",",
"phosphatidylcholine",
"17:0/17:0",
"(",
"PC",
")",
",",
"phosphatidylethanolamine",
"17:0/17:0",
"(",
"PE",
")",
",",
"phosphatidylglycerol",
"17:0/17:0",
"(",
"PG",
")",
",",
"phosphatidylinositol",
"16:0/16:0",
"(",
"PI",
")",
",",
"phosphatidylserine",
"17:0/17:0",
"(",
"PS",
")",
",",
"cholesterol",
"ester",
"20:0",
"(",
"CE",
")",
",",
"sphingomyelin",
"18:1;2/12:0;0",
"(",
"SM",
")",
",",
"triacylglycerol",
"17:0/17:0/17:0",
"(",
"TAG",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O",
"B-Lipid",
"O",
"O"
] |
[
"After",
"extraction",
",",
"the",
"organic",
"phase",
"was",
"transferred",
"to",
"an",
"infusion",
"plate",
"and",
"dried",
"in",
"a",
"speed",
"vacuum",
"concentrator",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"1st",
"step",
"dry",
"extract",
"was",
"re-suspended",
"in",
"7.5",
"mM",
"ammonium",
"acetate",
"in",
"chloroform/methanol/propanol",
"(",
"1:2:4",
",",
"V",
":",
"V",
":",
"V",
")",
"and",
"2nd",
"step",
"dry",
"extract",
"in",
"33",
"%",
"ethanol",
"solution",
"of",
"methylamine",
"in",
"chloroform/methanol",
"(",
"0.003:5:1",
";",
"V",
":",
"V",
":",
"V",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"All",
"liquid",
"handling",
"steps",
"were",
"performed",
"using",
"Hamilton",
"Robotics",
"STARlet",
"robotic",
"platform",
"with",
"the",
"Anti",
"Droplet",
"Control",
"feature",
"for",
"organic",
"solvents",
"pipetting",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Samples",
"were",
"analyzed",
"by",
"direct",
"infusion",
"on",
"a",
"QExactive",
"mass",
"spectrometer",
"(",
"Thermo",
"Scientific",
")",
"equipped",
"with",
"a",
"TriVersa",
"NanoMate",
"ion",
"source",
"(",
"Advion",
"Biosciences",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Samples",
"were",
"analyzed",
"in",
"both",
"positive",
"and",
"negative",
"ion",
"modes",
"with",
"a",
"resolution",
"of",
"Rm/z",
"=",
"200",
"=",
"280000",
"for",
"MS",
"and",
"Rm/z",
"=",
"200",
"=",
"17500",
"for",
"MSMS",
"experiments",
",",
"in",
"a",
"single",
"acquisition",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"MSMS",
"was",
"triggered",
"by",
"an",
"inclusion",
"list",
"encompassing",
"corresponding",
"MS",
"mass",
"ranges",
"scanned",
"in",
"1",
"Da",
"increments",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Both",
"MS",
"and",
"MSMS",
"data",
"were",
"combined",
"to",
"monitor",
"CE",
",",
"DAG",
"and",
"TAG",
"ions",
"as",
"ammonium",
"adducts",
";",
"PC",
",",
"PC",
"O-",
",",
"as",
"acetate",
"adducts",
";",
"and",
"CL",
",",
"PA",
",",
"PE",
",",
"PE",
"O-",
",",
"PG",
",",
"PI",
"and",
"PS",
"as",
"deprotonated",
"anions",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"O",
"O",
"O"
] |
[
"MS",
"only",
"was",
"used",
"to",
"monitor",
"LPA",
",",
"LPE",
",",
"LPE",
"O-",
",",
"LPI",
"and",
"LPS",
"as",
"deprotonated",
"anions",
";",
"Cer",
",",
"HexCer",
",",
"SM",
",",
"LPC",
"and",
"LPC",
"O-",
"as",
"acetate",
"adducts",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"B-Lipid",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O"
] |
[
"Data",
"were",
"analyzed",
"with",
"in-house",
"developed",
"lipid",
"identification",
"software",
"based",
"on",
"LipidXplorer",
"[",
"60",
",",
"61",
"]",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Only",
"lipid",
"identifications",
"with",
"a",
"signal-to-noise",
"ratio",
">",
"5",
",",
"and",
"a",
"signal",
"intensity",
"5-fold",
"higher",
"than",
"in",
"corresponding",
"blank",
"samples",
"were",
"considered",
"for",
"further",
"data",
"analysis",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Measured",
"lipid",
"amounts",
"were",
"normalized",
"to",
"total",
"lipid",
"amount",
"in",
"samples",
"and",
"log-transformed",
"to",
"approach",
"a",
"symmetric",
"and",
"approximative",
"normal",
"distribution",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Lipid",
"species",
"with",
"missing",
"values",
"across",
"many",
"samples",
"were",
"removed",
"from",
"further",
"analysis",
",",
"and",
"in",
"total",
",",
"we",
"evaluated",
"the",
"results",
"of",
"225",
"lipid",
"species",
"in",
"the",
"mouse",
"and",
"147",
"in",
"the",
"human",
"data",
"set",
"."
] |
[
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"O"
] |
[
"Normal",
"distribution",
"was",
"checked",
"visually",
"by",
"using",
"Q-Q",
"plots",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Depending",
"on",
"their",
"scale",
"and",
"distribution",
",",
"results",
"are",
"given",
"in",
"proportions",
",",
"mean",
",",
"standard",
"deviation",
"or",
"standard",
"error",
"of",
"the",
"median",
"with",
"25",
"%",
"to",
"75",
"%",
"quartiles",
"as",
"indicated",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Statistical",
"tests",
"for",
"significance",
"were",
"performed",
"by",
"using",
"the",
"tow-tailed",
"t-test",
"or",
"Mann-Whitney-U-test",
"as",
"appropriate",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Multivariable",
"analysis",
"was",
"done",
"by",
"linear",
"and",
"robust",
"linear",
"regression",
"with",
"log-transformed",
"relative",
"lipid",
"amounts",
"as",
"dependent",
"and",
"experimental",
"or",
"clinical",
"conditions",
",",
"age",
"and",
"BMI",
",",
"as",
"independent",
"variables",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"For",
"class",
"level",
"comparisons",
"only",
",",
"we",
"used",
"regression",
"or",
"median",
"imputation",
"of",
"missing",
"values",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"To",
"avoid",
"alpha",
"inflation",
",",
"p-values",
"were",
"adjusted",
"by",
"the",
"Benjamini-Hochberg",
"procedure",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Adjusted",
"p-values",
"of",
"less",
"than",
"<",
"0.1",
"were",
"considered",
"to",
"be",
"significant",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"All",
"analyses",
"were",
"performed",
"with",
"R",
"version",
"3.3.1",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"See",
"S1",
"Supporting",
"Information",
"for",
"further",
"details",
"regarding",
"data",
"analysis",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"To",
"compare",
"differences",
"between",
"groups",
"of",
"mice",
"phenotypes",
",",
"we",
"performed",
"two-way",
"ANOVA",
"(",
"Bonferroni",
"posttest",
")",
",",
"two-way",
"ANOVA",
"with",
"repeated",
"measures",
"(",
"Bonferroni",
"posttest",
")",
"or",
"t-test",
",",
"as",
"appropriate",
",",
"and",
"data",
"was",
"analyzed",
"with",
"GraphPad",
"Prism",
"Software",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Statistical",
"significance",
"was",
"assumed",
"at",
"p<0.05",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Vertical",
"lines",
"in",
"the",
"histograms",
"indicate",
"means",
"±",
"standard",
"error",
"of",
"the",
"mean",
"(",
"SEM",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"n-number",
"is",
"indicated",
"for",
"each",
"experiment",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Lysosome-associated",
"membrane",
"glycoprotein",
"3",
"(",
"LAMP3",
")",
"is",
"a",
"type",
"I",
"transmembrane",
"protein",
"of",
"the",
"LAMP",
"protein",
"family",
"with",
"a",
"cell-type-specific",
"expression",
"in",
"alveolar",
"type",
"II",
"cells",
"in",
"mice",
"and",
"hitherto",
"unknown",
"function",
"."
] |
[
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"B-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O"
] |
[
"In",
"type",
"II",
"pneumocytes",
",",
"LAMP3",
"is",
"localized",
"in",
"lamellar",
"bodies",
",",
"secretory",
"organelles",
"releasing",
"pulmonary",
"surfactant",
"into",
"the",
"extracellular",
"space",
"to",
"lower",
"surface",
"tension",
"at",
"the",
"air/liquid",
"interface",
"."
] |
[
"O",
"B-CellType",
"I-CellType",
"I-CellType",
"O",
"B-Protein",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"B-Tissue",
"I-Tissue",
"B-Function",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"physiological",
"function",
"of",
"LAMP3",
",",
"however",
",",
"remains",
"enigmatic",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"We",
"generated",
"Lamp3",
"knockout",
"mice",
"by",
"CRISPR/Cas9",
"."
] |
[
"O",
"O",
"B-Organism Variant",
"I-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O"
] |
[
"LAMP3",
"deficient",
"mice",
"are",
"viable",
"with",
"an",
"average",
"life",
"span",
"and",
"display",
"regular",
"lung",
"function",
"under",
"basal",
"conditions",
"."
] |
[
"B-Protein",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"levels",
"of",
"a",
"major",
"hydrophobic",
"protein",
"component",
"of",
"pulmonary",
"surfactant",
",",
"SP-C",
",",
"are",
"strongly",
"increased",
"in",
"the",
"lung",
"of",
"Lamp3",
"knockout",
"mice",
",",
"and",
"the",
"lipid",
"composition",
"of",
"the",
"bronchoalveolar",
"lavage",
"shows",
"mild",
"but",
"significant",
"changes",
",",
"resulting",
"in",
"alterations",
"in",
"surfactant",
"functionality",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"O",
"B-Organism Variant",
"I-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O"
] |
[
"In",
"ovalbumin-induced",
"experimental",
"allergic",
"asthma",
",",
"the",
"changes",
"in",
"lipid",
"composition",
"are",
"aggravated",
",",
"and",
"LAMP3-deficient",
"mice",
"exert",
"an",
"increased",
"airway",
"resistance",
"."
] |
[
"O",
"B-Disease",
"I-Disease",
"I-Disease",
"I-Disease",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"B-Organism Variant",
"B-Organism",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O"
] |
[
"Our",
"data",
"suggest",
"a",
"critical",
"role",
"of",
"LAMP3",
"in",
"the",
"regulation",
"of",
"pulmonary",
"surfactant",
"homeostasis",
"and",
"normal",
"lung",
"function",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"B-Function",
"O",
"O",
"B-Function",
"I-Function",
"O"
] |
[
"The",
"lysosome-associated",
"membrane",
"glycoprotein",
"(",
"LAMP",
")",
"family",
"consists",
"of",
"five",
"members",
"(",
"LAMP1",
",",
"LAMP2",
",",
"LAMP3",
"/",
"DC-LAMP",
",",
"CD68",
"/",
"macrosialin",
",",
"and",
"LAMP5",
"(",
"BAD-LAMP",
")",
")",
"."
] |
[
"O",
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O"
] |
[
"All",
"family",
"members",
"are",
"heavily",
"N-",
"and",
"O-glycosylated",
"type",
"I",
"transmembrane",
"proteins",
"localized",
"to",
"the",
"limiting",
"membrane",
"of",
"lysosomes",
"and",
"lysosome-related",
"organelles",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"O",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"LAMP1",
"and",
"LAMP2",
"are",
"ubiquitously",
"expressed",
",",
"while",
"LAMP3",
"(",
"synonymously",
"called",
"DC-LAMP",
")",
",",
"CD68",
",",
"and",
"LAMP5",
"show",
"cell-type-specific",
"or",
"tissue-specific",
"expression",
"."
] |
[
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"B-Protein",
"O",
"O",
"B-Protein",
"O",
"B-Function",
"I-Function",
"I-Function",
"I-Function",
"O"
] |
[
"CD68",
"expression",
"is",
"restricted",
"to",
"macrophages",
",",
"monocytes",
",",
"and",
"microglia",
",",
"whereas",
"LAMP5",
"is",
"expressed",
"exclusively",
"in",
"the",
"brain",
"."
] |
[
"B-Protein",
"O",
"O",
"O",
"O",
"B-CellType",
"O",
"B-CellType",
"O",
"O",
"B-CellType",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"LAMP3-expression",
"pattern",
"between",
"humans",
"and",
"mice",
"differs",
":",
"LAMP3",
"is",
"expressed",
"in",
"humans",
"in",
"alveolar",
"type",
"II",
"(",
"AT2",
")",
"cells",
"and",
"dendritic",
"cells",
"(",
"DC",
")",
"(",
"eponymously",
"for",
"its",
"alternative",
"name",
"\"",
"DC-LAMP",
"\"",
"or",
"CD208",
")",
"."
] |
[
"O",
"O",
"I-Function",
"O",
"B-Organism",
"O",
"B-Organism",
"O",
"O",
"B-Protein",
"O",
"B-Function",
"O",
"B-Organism",
"O",
"B-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"O",
"B-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"I-CellType",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellType",
"O",
"O",
"B-CellType",
"O",
"O"
] |
[
"In",
"mice",
",",
"LAMP3",
"is",
"found",
"exclusively",
"in",
"AT2",
"cells",
"but",
"not",
"in",
"DCs",
"[",
"4–7",
"]",
"."
] |
[
"O",
"B-Organism",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"B-CellType",
"I-CellType",
"O",
"O",
"O",
"B-CellType",
"O",
"O",
"O",
"O"
] |
[
"These",
"findings",
"suggest",
"a",
"conserved",
"and",
"critical",
"function",
"of",
"LAMP3",
"in",
"AT2",
"cells",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-CellType",
"I-CellType",
"O"
] |
[
"On",
"the",
"subcellular",
"levels",
",",
"LAMP3",
"is",
"localized",
"in",
"lamellar",
"bodies",
"(",
"LBs",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"I-Tissue",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"However",
",",
"the",
"function",
"of",
"LAMP3",
"in",
"these",
"cells",
"remains",
"enigmatic",
"until",
"now",
";",
"if",
"and",
"how",
"LAMP3",
"affects",
"surfactant",
"homeostasis",
",",
"e.g.",
",",
"mediating",
"surfactant",
"release",
"via",
"LBs",
",",
"is",
"also",
"poorly",
"understood",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Lipid",
"B-Function",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"primary",
"function",
"of",
"AT2",
"cells",
"is",
"mainly",
"attributed",
"to",
"pulmonary",
"surfactant",
"release",
"to",
"lower",
"surface",
"tension",
"at",
"the",
"lung",
"’s",
"air/liquid",
"interface",
"."
] |
[
"O",
"O",
"O",
"O",
"B-CellType",
"I-CellType",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"I-Function",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"O",
"O"
] |
[
"Pulmonary",
"surfactant",
"is",
"a",
"mixture",
"of",
"lipids",
"and",
"proteins",
":",
"The",
"major",
"hydrophobic",
"protein",
"components",
",",
"surfactant",
"proteins",
"B",
"(",
"SP-B",
")",
"and",
"C",
"(",
"SP-C",
")",
",",
"are",
"small",
"proteins",
"deeply",
"embedded",
"into",
"the",
"phospholipids",
"of",
"the",
"surfactant",
"."
] |
[
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"B-Protein",
"I-Protein",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O"
] |
[
"Notably",
",",
"deficiency",
"in",
"SP-B",
"or",
"SP-C",
"due",
"to",
"genetic",
"mutations",
"in",
"SFTPB",
"or",
"SFTPC",
"cause",
"hereditary",
"forms",
"of",
"childhood",
"interstitial",
"lung",
"disease",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"I-Function",
"I-Function",
"O"
] |
[
"Sftpb",
"gene-targeted",
"mice",
"die",
"of",
"respiratory",
"failure",
"after",
"birth",
",",
"associated",
"with",
"irregular",
"and",
"dysfunctional",
"LBs",
"and",
"tubular",
"myelin",
"."
] |
[
"B-Protein",
"B-Organism Variant",
"I-Organism Variant",
"O",
"O",
"B-Disease",
"I-Disease",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"O",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"SP-C",
"deficient",
"mice",
"have",
"a",
"regular",
"life",
"span",
"and",
"only",
"show",
"subtle",
"deficits",
"in",
"lung",
"mechanics",
"and",
"surfactant",
"stability",
"."
] |
[
"B-Protein",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"composition",
"of",
"surfactant",
"lipids",
"has",
"been",
"analyzed",
"extensively",
"[",
"13–17",
"]",
"."
] |
[
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"most",
"abundant",
"and",
"characteristic",
"lipid",
"class",
"is",
"phosphatidylcholine",
"(",
"PC",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"I-Lipid"
] |
[
"PC",
"makes",
"up",
"approximately",
"70",
"%",
"of",
"the",
"total",
"surfactant",
"mass",
"with",
"dipalmitoylphosphatidylcholine",
"(",
"DPPC",
";",
"PC",
"16:0/16:0",
")",
"as",
"the",
"primary",
"lipid",
"species",
"."
] |
[
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O"
] |
[
"An",
"overall",
"decrease",
"of",
"PC",
"lipids",
"is",
"coupled",
"to",
"higher",
"surface",
"tension",
"and",
"lower",
"surfactant",
"protein",
"inclusion",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Other",
"highly",
"abundant",
"and",
"functionally",
"essential",
"phospholipid",
"classes",
"in",
"surfactant",
"include",
"phosphatidylglycerol",
"(",
"PG",
")",
"and",
"phosphatidylinositol",
"(",
"PI",
")",
",",
"while",
"phosphatidylethanolamine",
"(",
"PE",
")",
",",
"and",
"sphingomyelin",
"(",
"SM",
")",
"are",
"reported",
"as",
"minor",
"components",
"of",
"surfactant",
"and",
"most",
"likely",
"derived",
"from",
"other",
"cell",
"membranes",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"B-Lipid",
"I-Lipid",
"B-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"In",
"addition",
",",
"lysophosphatidylcholine",
"(",
"LPC",
")",
"can",
"be",
"found",
"in",
"low",
"abundance",
"in",
"pulmonary",
"surfactant",
"."
] |
[
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"I-Lipid",
"I-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Lipid",
"I-Lipid",
"O"
] |
[
"Preassembled",
"surfactant",
"is",
"stored",
"in",
"secretory",
"organelles",
"known",
"as",
"LB",
"that",
"fuse",
"with",
"the",
"cell",
"membranes",
"and",
"release",
"pulmonary",
"surfactant",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"O",
"B-Tissue",
"O",
"B-Function",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"B-Function",
"B-Lipid",
"I-Lipid",
"O"
] |
[
"LBs",
"are",
"multivesicular",
"body",
"/",
"late",
"endosome-derived",
"specialized",
"organelles",
"filled",
"with",
"surfactant",
"characterized",
"by",
"a",
"typical",
"\"",
"myelin\"-like",
"appearance",
"by",
"electron",
"microscopy",
"."
] |
[
"B-Tissue",
"O",
"B-Tissue",
"I-Tissue",
"O",
"B-Tissue",
"O",
"O",
"B-Tissue",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"O"
] |
[
"Phospholipids",
"are",
"directly",
"transferred",
"from",
"the",
"endoplasmic",
"reticulum",
"to",
"LB",
"through",
"a",
"vesicle-independent",
"mechanism",
"by",
"the",
"phospholipid",
"transporter",
"\"",
"ATP",
"binding",
"cassette",
"subfamily",
"A",
"member",
"3",
"\"",
"(",
"ABCA3",
")",
"."
] |
[
"B-Lipid",
"O",
"O",
"B-Function",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"B-Tissue",
"O",
"O",
"B-Function",
"I-Function",
"O",
"O",
"B-Protein",
"I-Protein",
"O",
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"O",
"O",
"B-Protein",
"O",
"O"
] |
[
"Like",
"SFTPB",
"or",
"SFTPC",
",",
"loss-of-function",
"mutations",
"in",
"ABCA3",
"were",
"identified",
"in",
"full-term",
"infants",
"who",
"died",
"from",
"unexplained",
"fatal",
"respiratory",
"distress",
"syndrome",
"."
] |
[
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Disease",
"I-Disease",
"I-Disease",
"I-Disease",
"O"
] |
[
"ABCA3",
"mutations",
"represent",
"the",
"most",
"frequent",
"form",
"of",
"congenital",
"surfactant",
"deficiencies",
"."
] |
[
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Disease",
"B-Lipid",
"I-Disease",
"O"
] |
[
"A",
"presumably",
"loss-of-function",
"mutation",
"in",
"LAMP3",
"(",
"p.(E387",
"K",
")",
")",
"was",
"recently",
"identified",
"in",
"an",
"Airedale",
"Terrier",
"dog",
"breed",
",",
"leading",
"to",
"severe",
"symptoms",
"and",
"pathology",
"similar",
"to",
"clinical",
"symptoms",
"of",
"the",
"most",
"severe",
"neonatal",
"forms",
"of",
"human",
"surfactant",
"deficiency",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"I-Protein",
"I-Protein",
"I-Protein",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"I-Organism",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"B-Disease",
"I-Disease",
"O"
] |
[
"The",
"affected",
"puppies",
"’",
"symptoms",
"included",
"lethal",
"hypoxic",
"respiratory",
"distress",
"and",
"occurred",
"within",
"the",
"first",
"days",
"or",
"weeks",
"of",
"life",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"B-Disease",
"I-Disease",
"I-Disease",
"I-Disease",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"LBs",
"were",
"smaller",
",",
"contained",
"fewer",
"lamellae",
",",
"and",
"occasionally",
"revealed",
"a",
"disrupted",
"common",
"limiting",
"membrane",
"."
] |
[
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"To",
"conclusively",
"address",
"the",
"physiological",
"role",
"of",
"LAMP3",
"in",
"surfactant",
"homeostasis",
"using",
"a",
"genetically",
"defined",
"animal",
"model",
",",
"we",
"generated",
"Lamp3",
"knockout",
"mice",
"(",
"KO",
",",
"Lamp3",
")",
"by",
"CRISPR/Cas9",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Lipid",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism Variant",
"I-Organism Variant",
"I-Organism Variant",
"O",
"B-Organism Variant",
"I-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"O"
] |
[
"In",
"contrast",
"to",
"dogs",
"bearing",
"a",
"natural",
"mutation",
"in",
"LAMP3",
",",
"Lamp3",
"mice",
"are",
"vital",
",",
"display",
"a",
"regular",
"lung",
"function",
"at",
"the",
"basal",
"level",
",",
"and",
"show",
"no",
"increased",
"prenatal",
"lethality",
"."
] |
[
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"The",
"lungs",
"of",
"Lamp3",
"animals",
"did",
"neither",
"macroscopically",
"nor",
"microscopically",
"differ",
"from",
"those",
"of",
"wild",
"type",
"littermates",
"."
] |
[
"O",
"B-Tissue",
"O",
"B-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism Variant",
"I-Organism Variant",
"O",
"O"
] |
[
"However",
",",
"biochemical",
"analysis",
"of",
"broncho-alveolar",
"lavage",
"(",
"BAL",
")",
"fluid",
"clearly",
"revealed",
"increased",
"pro-SP-C",
"levels",
"and",
"altered",
"lipid",
"composition",
"in",
"the",
"Lamp3",
"mice",
"."
] |
[
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"B-Tissue",
"I-Tissue",
"I-Tissue",
"I-Tissue",
"I-Tissue",
"I-Tissue",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"B-Lipid",
"O",
"O",
"O",
"B-Organism Variant",
"B-Organism",
"O"
] |
[
"These",
"differences",
"are",
"further",
"pronounced",
"under",
"diseased",
"conditions",
"as",
"evoked",
"by",
"allergen-induced",
"experimental",
"asthma",
",",
"and",
"most",
"notably",
",",
"diseased",
"Lamp3",
"mice",
"revealed",
"significantly",
"increased",
"airway",
"resistance",
",",
"when",
"stressed",
"during",
"methacholine",
"provocation",
"testing",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Disease",
"I-Disease",
"B-Disease",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O"
] |
[
"In",
"conclusion",
",",
"our",
"data",
"suggest",
"a",
"critical",
"but",
"not",
"essential",
"role",
"of",
"LAMP3",
"in",
"pulmonary",
"surfactant",
"homeostasis",
"associated",
"with",
"normal",
"lung",
"function",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Function",
"I-Function",
"I-Function",
"O",
"O",
"O",
"B-Function",
"I-Function",
"O"
] |
[
"All",
"animal",
"studies",
"were",
"approved",
"by",
"the",
"local",
"animal",
"ethics",
"committe",
"(",
"Ministerium",
"für",
"Energiewende",
",",
"Landwirtschaft",
",",
"Umwelt",
",",
"Natur",
"und",
"Digitalisierung",
";",
"AZ",
"V242",
"-",
"4255/2018",
",",
"and",
"V244",
"-",
"2826/2017",
"(",
"32",
"-",
"3/17",
")",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Analytical",
"grade",
"chemicals",
"were",
"purchased",
",",
"if",
"not",
"stated",
"otherwise",
",",
"from",
"Sigma-Aldrich",
"(",
"MO",
".",
","
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"."
] |
[
"O"
] |
[
"Antibodies",
":",
"The",
"following",
"antibodies",
"were",
"used",
"in",
"the",
"study",
":",
"Rat",
"monoclonal",
"LAMP3",
",",
"clone",
"1006F7.05",
"(",
"Dendritics",
")",
",",
"SP-C",
",",
"rabbit",
"polyclonal",
"(",
"Abcam",
")",
",",
"rabbit",
"polyclonal",
"antibodies",
"against",
"mature",
"SP-B",
"and",
"Pro-SP-B",
"(",
"Seven",
"Hills",
"Bioreagents",
")",
"were",
"a",
"generous",
"gift",
"from",
"Jeffrey",
"A.",
"Whitsett",
",",
"polyclonal",
"β-Actin",
"(",
"Santa",
"Cruz",
"Biotechnology",
",",
"Inc",
")",
",",
"polyclonal",
"rabbit",
"antiserum",
"against",
"ABCA3",
"was",
"a",
"kind",
"gift",
"from",
"Michael",
"L.",
"Fitzgerald",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Organism",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Protein",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Fluorophore-conjugated",
"secondary",
"antibodies",
"against",
"the",
"corresponding",
"primary",
"antibody",
"species",
"(",
"AlexaFluor",
"488",
")",
"were",
"purchased",
"from",
"Invitrogen",
"/",
"Molecular",
"Probes",
"and",
"were",
"diluted",
"1:500",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Mice",
"with",
"a",
"null",
"mutation",
"in",
"the",
"Lamp3",
"gene",
"were",
"generated",
"in",
"a",
"C57BL/6N",
"background",
"using",
"a",
"CRISPR",
"genome-editing",
"system",
"."
] |
[
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"For",
"this",
"purpose",
",",
"Cas9",
"was",
"combined",
"with",
"two",
"single",
"guide",
"RNAs",
"(",
"sgRNAs",
")",
"targeting",
"the",
"second",
"exon",
"in",
"the",
"Lamp3",
"gene",
"with",
"the",
"following",
"spacer",
"sequences",
":",
"sgRNA_Lamp3",
"F1",
":",
"TCATCTACTGACGATACCAT",
"and",
"sgRNA_Lamp3",
"R1",
":",
"GCTAGACTAGCTCTGGTTGT",
"microinjected",
"into",
"fertilized",
"zygotes",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Genome",
"editing",
"was",
"confirmed",
"by",
"PCR",
"amplification",
"in",
"the",
"resulting",
"founder",
"mice",
"with",
"the",
"primers",
"Lamp3F",
"5´-GATGGGGGAGGGATCTTTTA-3",
"’",
"and",
"Lamp3R",
"5´-GTTGGCCTCTGATTGGTTGT-3",
"’",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"A",
"founder",
"harboring",
"a",
"40",
"bp",
"deletion",
"within",
"the",
"second",
"exon",
"leading",
"to",
"a",
"frameshift",
"mutation",
"was",
"selected",
"for",
"further",
"breeding",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Mice",
"were",
"housed",
"under",
"specific",
"pathogen-free",
"conditions",
"(",
"12",
"hours",
"’",
"light/dark",
"cycle",
",",
"constant",
"room",
"temperature",
",",
"and",
"humidity",
")",
"."
] |
[
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Food",
"and",
"water",
"were",
"available",
"ad",
"libitum",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Female",
",",
"6-",
"to",
"8-week-old",
"Lamp3",
"and",
"wildtype",
"littermates",
"mice",
"(",
"CAU",
",",
"Kiel",
",",
"Germany",
")",
"were",
"used",
"for",
"the",
"allergic",
"asthma",
"model",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Organism Variant",
"O",
"B-Organism Variant",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Disease",
"O",
"O"
] |
[
"They",
"received",
"ovalbumin",
"(OVA)-free",
"diet",
"and",
"water",
"ad",
"libitum",
"."
] |
[
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Mice",
"were",
"sensitized",
"to",
"OVA",
"by",
"three",
"intraperitoneal",
"(",
"i.p",
".",
")"
] |
[
"B-Organism",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"injections",
"of",
"10",
"μg",
"of",
"OVA",
"(",
"OVA",
"grade",
"VI",
",",
"Sigma-Aldrich",
",",
"St.",
"Louis",
",",
"MO",
",",
"USA",
")",
"adsorbed",
"to",
"150",
"μg",
"of",
"aluminum",
"hydroxide",
"(",
"imject",
"alum",
",",
"Thermo",
"Fisher",
"Scientific",
",",
"Waltham",
",",
"MA",
",",
"USA",
")",
"on",
"days",
"1",
",",
"14",
"and",
"21",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"To",
"induce",
"acute",
"allergic",
"airway",
"inflammation",
",",
"mice",
"were",
"exposed",
"three",
"times",
"to",
"an",
"OVA",
"(",
"OVA",
"grade",
"V",
",",
"Sigma-Aldrich",
")",
"aerosol",
"(",
"1",
"%",
"wt/vol",
"in",
"PBS",
")",
"on",
"days",
"26",
",",
"27",
",",
"and",
"28",
"."
] |
[
"O",
"O",
"O",
"B-Disease",
"I-Disease",
"I-Disease",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Control",
"animals",
"were",
"sham",
"sensitized",
"to",
"PBS",
"and",
"subsequently",
"challenged",
"with",
"OVA",
"aerosol",
"."
] |
[
"B-Organism Variant",
"I-Organism Variant",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O"
] |
[
"Steady-state",
"lung",
"parameters",
"midexpiratory",
"flow",
"(",
"EF50",
")",
",",
"frequency",
"(",
"f",
")",
",",
"functional",
"residual",
"capacity",
"(",
"Frc",
")",
",",
"minute",
"volume",
"(",
"MV",
")",
",",
"peak",
"expiratory",
"flow",
"(",
"PEF",
")",
",",
"peak",
"inspiratory",
"flow",
"(",
"PIF",
")",
",",
"expiration",
"time",
"(",
"Te",
")",
",",
"inspiration",
"time",
"(",
"Ti",
")",
",",
"and",
"tidal",
"volume",
"(",
"TV",
")",
"were",
"measured",
"in",
"conscious",
",",
"spontaneously",
"breathing",
"mice",
"using",
"FinePointe",
"non-invasive",
"airway",
"mechanics",
"double-chamber",
"plethysmography",
"(",
"NAM",
",",
"Data",
"Science",
"International",
",",
"St.",
"Paul",
",",
"MN",
",",
"USA",
")",
"."
] |
[
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"B-Assay Type",
"I-Assay Type",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"B-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Steady-state",
"airway",
"resistance",
"(",
"RI",
")",
"and",
"dynamic",
"compliance",
"(",
"Cdyn",
")",
"were",
"measured",
"in",
"anesthetized",
"and",
"ventilated",
"mice",
"using",
"FinePointe",
"RC",
"Units",
"(",
"Data",
"Science",
"International",
")",
"."
] |
[
"O",
"B-Function",
"I-Function",
"I-Function",
"I-Function",
"I-Function",
"O",
"B-Function",
"I-Function",
"I-Function",
"I-Function",
"I-Function",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Organism",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Airway",
"responsiveness",
"to",
"methacholine",
"(",
"MCh",
",",
"acetyl-β-methylcholine",
"chloride",
";",
"Sigma-Aldrich",
")",
"challenge",
"was",
"invasively",
"assessed",
"on",
"day",
"29",
"using",
"FinePointe",
"RC",
"Units",
"(",
"Data",
"Science",
"International",
",",
"St.",
"Paul",
",",
"MN",
",",
"USA",
")",
"by",
"continuous",
"measurement",
"of",
"RI",
"."
] |
[
"B-Function",
"I-Function",
"O",
"B-Metabolite",
"I-Assay Type",
"B-Metabolite",
"I-Assay Type",
"B-Metabolite",
"I-Metabolite",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"I-Assay Type",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Assay Type",
"I-Assay Type",
"O",
"B-Function",
"O"
] |
[
"Animals",
"were",
"anesthetized",
"with",
"ketamine",
"(",
"90",
"mg/kg",
"body",
"weight",
";",
"cp-pharma",
")",
"and",
"xylazine",
"(",
"10",
"mg/kg",
"BW",
";",
"cp-pharma",
")",
"and",
"tracheotomized",
"with",
"a",
"cannula",
"."
] |
[
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Mechanical",
"ventilation",
"was",
"previously",
"described",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"Measurements",
"were",
"taken",
"at",
"baseline",
"(",
"PBS",
")",
"and",
"in",
"response",
"to",
"inhalation",
"of",
"increased",
"concentrations",
"of",
"aerosolized",
"methacholine",
"(",
"3.125",
";",
"6.25",
";",
"12.5",
";",
"25",
";",
"50",
";",
"and",
"100",
"mg/mL",
")",
"."
] |
[
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"After",
"assessment",
"of",
"lung",
"function",
",",
"all",
"animals",
"were",
"sacrificed",
"by",
"cervical",
"dislocation",
"under",
"deep",
"anesthesia",
"."
] |
[
"O",
"O",
"O",
"B-Function",
"I-Function",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
[
"For",
"bronchoalveolar",
"lavage",
",",
"lungs",
"were",
"rinsed",
"with",
"1",
"ml",
"of",
"fresh",
",",
"ice-cold",
"PBS",
"containing",
"protease",
"inhibitor",
"(",
"Complete",
",",
"Roche",
",",
"Basel",
",",
"Switzerland",
")",
"via",
"a",
"tracheal",
"cannula",
"."
] |
[
"O",
"B-Tissue",
"I-Tissue",
"O",
"B-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Metabolite",
"I-Metabolite",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-Tissue",
"I-Tissue",
"O"
] |
[
"Cells",
"in",
"BAL",
"fluid",
"were",
"counted",
"in",
"the",
"Neubauer",
"chamber",
"."
] |
[
"O",
"O",
"B-Tissue",
"I-Tissue",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.